algorithms imagej nih (Oxford Instruments)
Oxford Instruments is a verified supplier 
Oxford Instruments manufactures this product 
99
Structured Review
Oxford Instruments
algorithms imagej nih
Algorithms Imagej Nih, supplied by Oxford Instruments, used in various techniques. Bioz Stars score: 99/100, based on 44474 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/algorithms+imagej/Imaris/pm41824461-294-101-105
Average 99 stars, based on 44474 article reviews
Algorithms Imagej Nih, supplied by Oxford Instruments, used in various techniques. Bioz Stars score: 99/100, based on 44474 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/algorithms+imagej/Imaris/pm41824461-294-101-105
Average 99 stars, based on 44474 article reviews
algorithms imagej nih - by Bioz Stars,
2026-11
99/100 stars
Images
Related Articles
Recombinant:Article Title: Identification of a discrete subpopulation of spinal cord ependymal cells with neural stem cell properties. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Chicken anti-Nestin Neuromics Cat #CH23001,RRID: AB_2148920 Goat anti-Nestin Neuromics Cat # GT15114,RRID: AB_2737217 Goat anti-Podocalyxin R&D Cat # AF1556,RRID: AB_354858 Goat anti-Sox2 Santa Cruz Cat # sc-17320, RRID: AB_2286684 Rabbit anti-Sox2 Abcam Cat # ab97959, RRID: AB_2341193 Goat anti-Sox9 R&D Cat # AF3075, RRID: AB_2194160 Rabbit anti-Gfap Dako Cat # GA524, RRID: AB_2811722 Rabbit anti-Myrf Gift from M. Wegner N/A Mouse anti-O4 Gift from JE. .. Goldman N/A Mouse anti-Tuj1 BioLegend Cat # 801201, RRID: AB_2313773 Chemicals, peptides, and recombinant proteins Tamoxifen Sigma Cat # T5648 EdU Thermo Fisher Cat # E10415 DAPI Sigma Cat # D9542 Critical commercial assays Click-iT EdU Alexa Fluor (488, 555 and 647) imaging kit Thermo Fisher Cat # C10337 (488), Cat # C10338 (555), Cat # C10340 (647) RNAscope Multiplex Fluorescent v2 kit ACDBio Cat # 323100 Chromium Single Cell 3’ Reagent Kit v2 10X Genomics Cat # PN-120237 Neural Tissue Dissociation Kit Miltenyi Biotec Cat # 130-092-628 Deposited data scRNaseq (raw data and gene expression matrices) This paper GEO: GSE192824 Code for scRNAseq analysis This paper https://doi.org/10.5281/zenodo.5851719 Experimental models: Organisms/strains Troy-CreERT2 x Rosa26-tdTomato This paper N/A Troy-CreERT2 x Rosa26-Confetti This paper N/A Software and Article Title: Rhesus macaque versus rat divergence in the corticospinal projectome. Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies RFP AbCam Cat# 73 34771 Chicken GFP Aves Cat# GFP1020 Rabbit RFP Rockland Cat# 601-401-379 Rabbit Ap2b Santa Cruz Biotechnology Cat# sc-8976 Mouse NeuN Encore Cat# MLA1B7 Sheep Chox10 Abcam Cat# ab16141 Goat ChAT Genetex Cat# GTX213110-04 Goat Satb1 Santa Cruz Biotechnology Cat# sc-376096 Mouse Synaptophysin (SYN) Novus bio Cat# nb300-653 Bacterial and virus strains AAV9-CAMKII-Cre-SV40 Penn Vector Core AV-9-PV2396 AAVDJ-CAG-FLEX-ArchT-tdTomato Salk Institute GT3 core N/A Cre-dependent HSV-H129DTK-tdTomato See Lo and Anderson, 2011 N/A HSV-H129DTK-tdTomato CNNV, Princeton N/A pAAV-hSyn1-ddCre N/A AVVDJ-FLEX-ArchT-TdTomato N/A AAV8-FLEX-ChR2-GFP UNC Vector Core N/A AAVdj-CAG-DIO-gCOMET Salk Institute GT3 core N/A AAVrg-pmSyn1-EBFP-Cre Salk Institute GT3 core N/A AVVDJ-FLEX-ArchT-TdTomato N/A pAAV-hSyn1-ddCre N/A Chemicals, peptides, and recombinant proteins Trimethoprim (TMP) Millipore Sigma Cat# 738-70-5 Experimental models: Organisms/strains Rat: Fisher 344 (F344/NHsd) Envigo N/A Rhesus macaques (Macaca mulatta) See Rosenzweig et al., 2018 N/A Software and Article Title: Correlative multiscale 3D imaging of mouse primary and metastatic tumors by sequential light sheet and confocal fluorescence microscopy Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies anti-CK8 BioLegend 1E8 anti-CD45 BioLegend 30-F11 anti-ER-TR7 BioXcell ER-TR7 Chemicals, peptides, and recombinant proteins DyLight488-NHS ester Thermo Scientific Cat#: 46402 DyLight550-NHS ester Thermo Scientific Cat#: 62262 DyLight680-NHS ester Thermo Scientific Cat#46418 DAPI Thermo Scientific Cat#: 62248 RPMI1640 cell culture media GibcoTM Cat#: 22400089 Bovine Serum Albumin Millipore Sigma Cat#: A2058 Dulbecco’s Modified Eagle’s MediumHigh glucose Millipore Sigma Cat#: D5671 DMXAA Millipore Sigma Cat#: D5817 Triethylamine Millipore Sigma Cat#471283 LE Quick Dissolve Agarose GeneMate E-3119-500 Dibenzyl ether Millipore Sigma Cat#108014 Ethyl cinnamate Millipore Sigma Cat#112372 1-thioglycerol Millipore Sigma Cat#471283 Spiropyran Millipore Sigma Cat# 273619 D-fructose Millipore Sigma Cat#: F0127 Experimental models: Cell lines TUBO Cell line Dr. Stephen Kron (University of Chicago) BALB-NeuT female mouse Luciferaseexpressing E0771 cells Dr.Zongmin Zhao(University of Illinois Chicago) C57BL/6 female mouse Experimental models: Organisms/strains C57BL/6J female mice Jackson Laboratories Stock No: 000664 BALB/c female mice Envigo Experimental models: Organisms/strains Software and Article Title: Classical monocyte ontogeny dictates their functions and fates as tissue macrophages. Article Snippet: Article Imaging:Article Title: Identification of a discrete subpopulation of spinal cord ependymal cells with neural stem cell properties. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Chicken anti-Nestin Neuromics Cat #CH23001,RRID: AB_2148920 Goat anti-Nestin Neuromics Cat # GT15114,RRID: AB_2737217 Goat anti-Podocalyxin R&D Cat # AF1556,RRID: AB_354858 Goat anti-Sox2 Santa Cruz Cat # sc-17320, RRID: AB_2286684 Rabbit anti-Sox2 Abcam Cat # ab97959, RRID: AB_2341193 Goat anti-Sox9 R&D Cat # AF3075, RRID: AB_2194160 Rabbit anti-Gfap Dako Cat # GA524, RRID: AB_2811722 Rabbit anti-Myrf Gift from M. Wegner N/A Mouse anti-O4 Gift from JE. .. Goldman N/A Mouse anti-Tuj1 BioLegend Cat # 801201, RRID: AB_2313773 Chemicals, peptides, and recombinant proteins Tamoxifen Sigma Cat # T5648 EdU Thermo Fisher Cat # E10415 DAPI Sigma Cat # D9542 Critical commercial assays Click-iT EdU Alexa Fluor (488, 555 and 647) imaging kit Thermo Fisher Cat # C10337 (488), Cat # C10338 (555), Cat # C10340 (647) RNAscope Multiplex Fluorescent v2 kit ACDBio Cat # 323100 Chromium Single Cell 3’ Reagent Kit v2 10X Genomics Cat # PN-120237 Neural Tissue Dissociation Kit Miltenyi Biotec Cat # 130-092-628 Deposited data scRNaseq (raw data and gene expression matrices) This paper GEO: GSE192824 Code for scRNAseq analysis This paper https://doi.org/10.5281/zenodo.5851719 Experimental models: Organisms/strains Troy-CreERT2 x Rosa26-tdTomato This paper N/A Troy-CreERT2 x Rosa26-Confetti This paper N/A Software and RNAscope:Article Title: Identification of a discrete subpopulation of spinal cord ependymal cells with neural stem cell properties. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Chicken anti-Nestin Neuromics Cat #CH23001,RRID: AB_2148920 Goat anti-Nestin Neuromics Cat # GT15114,RRID: AB_2737217 Goat anti-Podocalyxin R&D Cat # AF1556,RRID: AB_354858 Goat anti-Sox2 Santa Cruz Cat # sc-17320, RRID: AB_2286684 Rabbit anti-Sox2 Abcam Cat # ab97959, RRID: AB_2341193 Goat anti-Sox9 R&D Cat # AF3075, RRID: AB_2194160 Rabbit anti-Gfap Dako Cat # GA524, RRID: AB_2811722 Rabbit anti-Myrf Gift from M. Wegner N/A Mouse anti-O4 Gift from JE. .. Goldman N/A Mouse anti-Tuj1 BioLegend Cat # 801201, RRID: AB_2313773 Chemicals, peptides, and recombinant proteins Tamoxifen Sigma Cat # T5648 EdU Thermo Fisher Cat # E10415 DAPI Sigma Cat # D9542 Critical commercial assays Click-iT EdU Alexa Fluor (488, 555 and 647) imaging kit Thermo Fisher Cat # C10337 (488), Cat # C10338 (555), Cat # C10340 (647) RNAscope Multiplex Fluorescent v2 kit ACDBio Cat # 323100 Chromium Single Cell 3’ Reagent Kit v2 10X Genomics Cat # PN-120237 Neural Tissue Dissociation Kit Miltenyi Biotec Cat # 130-092-628 Deposited data scRNaseq (raw data and gene expression matrices) This paper GEO: GSE192824 Code for scRNAseq analysis This paper https://doi.org/10.5281/zenodo.5851719 Experimental models: Organisms/strains Troy-CreERT2 x Rosa26-tdTomato This paper N/A Troy-CreERT2 x Rosa26-Confetti This paper N/A Software and Multiplex Assay:Article Title: Identification of a discrete subpopulation of spinal cord ependymal cells with neural stem cell properties. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Chicken anti-Nestin Neuromics Cat #CH23001,RRID: AB_2148920 Goat anti-Nestin Neuromics Cat # GT15114,RRID: AB_2737217 Goat anti-Podocalyxin R&D Cat # AF1556,RRID: AB_354858 Goat anti-Sox2 Santa Cruz Cat # sc-17320, RRID: AB_2286684 Rabbit anti-Sox2 Abcam Cat # ab97959, RRID: AB_2341193 Goat anti-Sox9 R&D Cat # AF3075, RRID: AB_2194160 Rabbit anti-Gfap Dako Cat # GA524, RRID: AB_2811722 Rabbit anti-Myrf Gift from M. Wegner N/A Mouse anti-O4 Gift from JE. .. Goldman N/A Mouse anti-Tuj1 BioLegend Cat # 801201, RRID: AB_2313773 Chemicals, peptides, and recombinant proteins Tamoxifen Sigma Cat # T5648 EdU Thermo Fisher Cat # E10415 DAPI Sigma Cat # D9542 Critical commercial assays Click-iT EdU Alexa Fluor (488, 555 and 647) imaging kit Thermo Fisher Cat # C10337 (488), Cat # C10338 (555), Cat # C10340 (647) RNAscope Multiplex Fluorescent v2 kit ACDBio Cat # 323100 Chromium Single Cell 3’ Reagent Kit v2 10X Genomics Cat # PN-120237 Neural Tissue Dissociation Kit Miltenyi Biotec Cat # 130-092-628 Deposited data scRNaseq (raw data and gene expression matrices) This paper GEO: GSE192824 Code for scRNAseq analysis This paper https://doi.org/10.5281/zenodo.5851719 Experimental models: Organisms/strains Troy-CreERT2 x Rosa26-tdTomato This paper N/A Troy-CreERT2 x Rosa26-Confetti This paper N/A Software and Single Cell:Article Title: Identification of a discrete subpopulation of spinal cord ependymal cells with neural stem cell properties. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Chicken anti-Nestin Neuromics Cat #CH23001,RRID: AB_2148920 Goat anti-Nestin Neuromics Cat # GT15114,RRID: AB_2737217 Goat anti-Podocalyxin R&D Cat # AF1556,RRID: AB_354858 Goat anti-Sox2 Santa Cruz Cat # sc-17320, RRID: AB_2286684 Rabbit anti-Sox2 Abcam Cat # ab97959, RRID: AB_2341193 Goat anti-Sox9 R&D Cat # AF3075, RRID: AB_2194160 Rabbit anti-Gfap Dako Cat # GA524, RRID: AB_2811722 Rabbit anti-Myrf Gift from M. Wegner N/A Mouse anti-O4 Gift from JE. .. Goldman N/A Mouse anti-Tuj1 BioLegend Cat # 801201, RRID: AB_2313773 Chemicals, peptides, and recombinant proteins Tamoxifen Sigma Cat # T5648 EdU Thermo Fisher Cat # E10415 DAPI Sigma Cat # D9542 Critical commercial assays Click-iT EdU Alexa Fluor (488, 555 and 647) imaging kit Thermo Fisher Cat # C10337 (488), Cat # C10338 (555), Cat # C10340 (647) RNAscope Multiplex Fluorescent v2 kit ACDBio Cat # 323100 Chromium Single Cell 3’ Reagent Kit v2 10X Genomics Cat # PN-120237 Neural Tissue Dissociation Kit Miltenyi Biotec Cat # 130-092-628 Deposited data scRNaseq (raw data and gene expression matrices) This paper GEO: GSE192824 Code for scRNAseq analysis This paper https://doi.org/10.5281/zenodo.5851719 Experimental models: Organisms/strains Troy-CreERT2 x Rosa26-tdTomato This paper N/A Troy-CreERT2 x Rosa26-Confetti This paper N/A Software and Gene Expression:Article Title: Identification of a discrete subpopulation of spinal cord ependymal cells with neural stem cell properties. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Chicken anti-Nestin Neuromics Cat #CH23001,RRID: AB_2148920 Goat anti-Nestin Neuromics Cat # GT15114,RRID: AB_2737217 Goat anti-Podocalyxin R&D Cat # AF1556,RRID: AB_354858 Goat anti-Sox2 Santa Cruz Cat # sc-17320, RRID: AB_2286684 Rabbit anti-Sox2 Abcam Cat # ab97959, RRID: AB_2341193 Goat anti-Sox9 R&D Cat # AF3075, RRID: AB_2194160 Rabbit anti-Gfap Dako Cat # GA524, RRID: AB_2811722 Rabbit anti-Myrf Gift from M. Wegner N/A Mouse anti-O4 Gift from JE. .. Goldman N/A Mouse anti-Tuj1 BioLegend Cat # 801201, RRID: AB_2313773 Chemicals, peptides, and recombinant proteins Tamoxifen Sigma Cat # T5648 EdU Thermo Fisher Cat # E10415 DAPI Sigma Cat # D9542 Critical commercial assays Click-iT EdU Alexa Fluor (488, 555 and 647) imaging kit Thermo Fisher Cat # C10337 (488), Cat # C10338 (555), Cat # C10340 (647) RNAscope Multiplex Fluorescent v2 kit ACDBio Cat # 323100 Chromium Single Cell 3’ Reagent Kit v2 10X Genomics Cat # PN-120237 Neural Tissue Dissociation Kit Miltenyi Biotec Cat # 130-092-628 Deposited data scRNaseq (raw data and gene expression matrices) This paper GEO: GSE192824 Code for scRNAseq analysis This paper https://doi.org/10.5281/zenodo.5851719 Experimental models: Organisms/strains Troy-CreERT2 x Rosa26-tdTomato This paper N/A Troy-CreERT2 x Rosa26-Confetti This paper N/A Software and Software:Article Title: Identification of a discrete subpopulation of spinal cord ependymal cells with neural stem cell properties. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Chicken anti-Nestin Neuromics Cat #CH23001,RRID: AB_2148920 Goat anti-Nestin Neuromics Cat # GT15114,RRID: AB_2737217 Goat anti-Podocalyxin R&D Cat # AF1556,RRID: AB_354858 Goat anti-Sox2 Santa Cruz Cat # sc-17320, RRID: AB_2286684 Rabbit anti-Sox2 Abcam Cat # ab97959, RRID: AB_2341193 Goat anti-Sox9 R&D Cat # AF3075, RRID: AB_2194160 Rabbit anti-Gfap Dako Cat # GA524, RRID: AB_2811722 Rabbit anti-Myrf Gift from M. Wegner N/A Mouse anti-O4 Gift from JE. .. Goldman N/A Mouse anti-Tuj1 BioLegend Cat # 801201, RRID: AB_2313773 Chemicals, peptides, and recombinant proteins Tamoxifen Sigma Cat # T5648 EdU Thermo Fisher Cat # E10415 DAPI Sigma Cat # D9542 Critical commercial assays Click-iT EdU Alexa Fluor (488, 555 and 647) imaging kit Thermo Fisher Cat # C10337 (488), Cat # C10338 (555), Cat # C10340 (647) RNAscope Multiplex Fluorescent v2 kit ACDBio Cat # 323100 Chromium Single Cell 3’ Reagent Kit v2 10X Genomics Cat # PN-120237 Neural Tissue Dissociation Kit Miltenyi Biotec Cat # 130-092-628 Deposited data scRNaseq (raw data and gene expression matrices) This paper GEO: GSE192824 Code for scRNAseq analysis This paper https://doi.org/10.5281/zenodo.5851719 Experimental models: Organisms/strains Troy-CreERT2 x Rosa26-tdTomato This paper N/A Troy-CreERT2 x Rosa26-Confetti This paper N/A Software and Article Title: Rhesus macaque versus rat divergence in the corticospinal projectome. Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies RFP AbCam Cat# 73 34771 Chicken GFP Aves Cat# GFP1020 Rabbit RFP Rockland Cat# 601-401-379 Rabbit Ap2b Santa Cruz Biotechnology Cat# sc-8976 Mouse NeuN Encore Cat# MLA1B7 Sheep Chox10 Abcam Cat# ab16141 Goat ChAT Genetex Cat# GTX213110-04 Goat Satb1 Santa Cruz Biotechnology Cat# sc-376096 Mouse Synaptophysin (SYN) Novus bio Cat# nb300-653 Bacterial and virus strains AAV9-CAMKII-Cre-SV40 Penn Vector Core AV-9-PV2396 AAVDJ-CAG-FLEX-ArchT-tdTomato Salk Institute GT3 core N/A Cre-dependent HSV-H129DTK-tdTomato See Lo and Anderson, 2011 N/A HSV-H129DTK-tdTomato CNNV, Princeton N/A pAAV-hSyn1-ddCre N/A AVVDJ-FLEX-ArchT-TdTomato N/A AAV8-FLEX-ChR2-GFP UNC Vector Core N/A AAVdj-CAG-DIO-gCOMET Salk Institute GT3 core N/A AAVrg-pmSyn1-EBFP-Cre Salk Institute GT3 core N/A AVVDJ-FLEX-ArchT-TdTomato N/A pAAV-hSyn1-ddCre N/A Chemicals, peptides, and recombinant proteins Trimethoprim (TMP) Millipore Sigma Cat# 738-70-5 Experimental models: Organisms/strains Rat: Fisher 344 (F344/NHsd) Envigo N/A Rhesus macaques (Macaca mulatta) See Rosenzweig et al., 2018 N/A Software and Article Title: Correlative multiscale 3D imaging of mouse primary and metastatic tumors by sequential light sheet and confocal fluorescence microscopy Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies anti-CK8 BioLegend 1E8 anti-CD45 BioLegend 30-F11 anti-ER-TR7 BioXcell ER-TR7 Chemicals, peptides, and recombinant proteins DyLight488-NHS ester Thermo Scientific Cat#: 46402 DyLight550-NHS ester Thermo Scientific Cat#: 62262 DyLight680-NHS ester Thermo Scientific Cat#46418 DAPI Thermo Scientific Cat#: 62248 RPMI1640 cell culture media GibcoTM Cat#: 22400089 Bovine Serum Albumin Millipore Sigma Cat#: A2058 Dulbecco’s Modified Eagle’s MediumHigh glucose Millipore Sigma Cat#: D5671 DMXAA Millipore Sigma Cat#: D5817 Triethylamine Millipore Sigma Cat#471283 LE Quick Dissolve Agarose GeneMate E-3119-500 Dibenzyl ether Millipore Sigma Cat#108014 Ethyl cinnamate Millipore Sigma Cat#112372 1-thioglycerol Millipore Sigma Cat#471283 Spiropyran Millipore Sigma Cat# 273619 D-fructose Millipore Sigma Cat#: F0127 Experimental models: Cell lines TUBO Cell line Dr. Stephen Kron (University of Chicago) BALB-NeuT female mouse Luciferaseexpressing E0771 cells Dr.Zongmin Zhao(University of Illinois Chicago) C57BL/6 female mouse Experimental models: Organisms/strains C57BL/6J female mice Jackson Laboratories Stock No: 000664 BALB/c female mice Envigo Experimental models: Organisms/strains Software and Article Title: Long-term engraftment and maturation of autologous iPSC-derived cardiomyocytes in two rhesus macaques. Article Snippet: In brief Lin and colleagues demonstrate that autologous cardiomyocytes derived from rhesus-macaque-induced pluripotent stem cells stably engraft long term, integrate, and fully mature in chronically infarcted hearts without immunosuppression.. Longitudinal noninvasive PET imaging detected grafts for up to 14 months post transplantation.. These findings will be highly relevant to future cardiac regenerative therapies. Article Title: Classical monocyte ontogeny dictates their functions and fates as tissue macrophages. Article Snippet: Article Article Title: Spatial-temporal proliferation of hepatocytes during pregnancy revealed by genetic lineage tracing. Article Snippet: Short article Virus:Article Title: Rhesus macaque versus rat divergence in the corticospinal projectome. Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies RFP AbCam Cat# 73 34771 Chicken GFP Aves Cat# GFP1020 Rabbit RFP Rockland Cat# 601-401-379 Rabbit Ap2b Santa Cruz Biotechnology Cat# sc-8976 Mouse NeuN Encore Cat# MLA1B7 Sheep Chox10 Abcam Cat# ab16141 Goat ChAT Genetex Cat# GTX213110-04 Goat Satb1 Santa Cruz Biotechnology Cat# sc-376096 Mouse Synaptophysin (SYN) Novus bio Cat# nb300-653 Bacterial and virus strains AAV9-CAMKII-Cre-SV40 Penn Vector Core AV-9-PV2396 AAVDJ-CAG-FLEX-ArchT-tdTomato Salk Institute GT3 core N/A Cre-dependent HSV-H129DTK-tdTomato See Lo and Anderson, 2011 N/A HSV-H129DTK-tdTomato CNNV, Princeton N/A pAAV-hSyn1-ddCre N/A AVVDJ-FLEX-ArchT-TdTomato N/A AAV8-FLEX-ChR2-GFP UNC Vector Core N/A AAVdj-CAG-DIO-gCOMET Salk Institute GT3 core N/A AAVrg-pmSyn1-EBFP-Cre Salk Institute GT3 core N/A AVVDJ-FLEX-ArchT-TdTomato N/A pAAV-hSyn1-ddCre N/A Chemicals, peptides, and recombinant proteins Trimethoprim (TMP) Millipore Sigma Cat# 738-70-5 Experimental models: Organisms/strains Rat: Fisher 344 (F344/NHsd) Envigo N/A Rhesus macaques (Macaca mulatta) See Rosenzweig et al., 2018 N/A Software and Article Title: Classical monocyte ontogeny dictates their functions and fates as tissue macrophages. Article Snippet: Article Cell Culture:Article Title: Correlative multiscale 3D imaging of mouse primary and metastatic tumors by sequential light sheet and confocal fluorescence microscopy Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies anti-CK8 BioLegend 1E8 anti-CD45 BioLegend 30-F11 anti-ER-TR7 BioXcell ER-TR7 Chemicals, peptides, and recombinant proteins DyLight488-NHS ester Thermo Scientific Cat#: 46402 DyLight550-NHS ester Thermo Scientific Cat#: 62262 DyLight680-NHS ester Thermo Scientific Cat#46418 DAPI Thermo Scientific Cat#: 62248 RPMI1640 cell culture media GibcoTM Cat#: 22400089 Bovine Serum Albumin Millipore Sigma Cat#: A2058 Dulbecco’s Modified Eagle’s MediumHigh glucose Millipore Sigma Cat#: D5671 DMXAA Millipore Sigma Cat#: D5817 Triethylamine Millipore Sigma Cat#471283 LE Quick Dissolve Agarose GeneMate E-3119-500 Dibenzyl ether Millipore Sigma Cat#108014 Ethyl cinnamate Millipore Sigma Cat#112372 1-thioglycerol Millipore Sigma Cat#471283 Spiropyran Millipore Sigma Cat# 273619 D-fructose Millipore Sigma Cat#: F0127 Experimental models: Cell lines TUBO Cell line Dr. Stephen Kron (University of Chicago) BALB-NeuT female mouse Luciferaseexpressing E0771 cells Dr.Zongmin Zhao(University of Illinois Chicago) C57BL/6 female mouse Experimental models: Organisms/strains C57BL/6J female mice Jackson Laboratories Stock No: 000664 BALB/c female mice Envigo Experimental models: Organisms/strains Software and Modification:Article Title: Correlative multiscale 3D imaging of mouse primary and metastatic tumors by sequential light sheet and confocal fluorescence microscopy Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies anti-CK8 BioLegend 1E8 anti-CD45 BioLegend 30-F11 anti-ER-TR7 BioXcell ER-TR7 Chemicals, peptides, and recombinant proteins DyLight488-NHS ester Thermo Scientific Cat#: 46402 DyLight550-NHS ester Thermo Scientific Cat#: 62262 DyLight680-NHS ester Thermo Scientific Cat#46418 DAPI Thermo Scientific Cat#: 62248 RPMI1640 cell culture media GibcoTM Cat#: 22400089 Bovine Serum Albumin Millipore Sigma Cat#: A2058 Dulbecco’s Modified Eagle’s MediumHigh glucose Millipore Sigma Cat#: D5671 DMXAA Millipore Sigma Cat#: D5817 Triethylamine Millipore Sigma Cat#471283 LE Quick Dissolve Agarose GeneMate E-3119-500 Dibenzyl ether Millipore Sigma Cat#108014 Ethyl cinnamate Millipore Sigma Cat#112372 1-thioglycerol Millipore Sigma Cat#471283 Spiropyran Millipore Sigma Cat# 273619 D-fructose Millipore Sigma Cat#: F0127 Experimental models: Cell lines TUBO Cell line Dr. Stephen Kron (University of Chicago) BALB-NeuT female mouse Luciferaseexpressing E0771 cells Dr.Zongmin Zhao(University of Illinois Chicago) C57BL/6 female mouse Experimental models: Organisms/strains C57BL/6J female mice Jackson Laboratories Stock No: 000664 BALB/c female mice Envigo Experimental models: Organisms/strains Software and Cross-linking Immunoprecipitation:Article Title: Classical monocyte ontogeny dictates their functions and fates as tissue macrophages. Article Snippet: Article other:Article Title: Sustained Trem2 stabilization accelerates microglia heterogeneity and Aβ pathology in a mouse model of Alzheimer's disease. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Critical commercial assays MSD-96-well Uplex 7-assay Meso Scale Discovery Cat# N05231A-1 Human (6E10) Abeta Peptide Ultrasensitive Kits Meso Scale Discovery Cat# N451FSA-1 CellTiter Glo Promega Cat# G755A Adult Brain Dissociation kit Miltenyi Biotech Cat# 130-107-677 Chromium Single Cell 30 library kit V2 10x Genomics Cat# P/N-120237 RNAscope Fluorescent Multiplex Detection Reagents ACD Cat# 320851 RNAscope protease III & IV Reagents ACD Cat# 322340 RNAscope probe Mm-Tyrobp-C3 ACD Cat# 408191-C3 RNAscope probe Mm-Cd9 ACD Cat# 430631 RNAscope probe Mm-Sox10-C3 ACD Cat# 435931-C3 RNAscope probe Mm-Serpina3n ACD Cat# 430191 LIVE/DEAD Fixable aqua Molecular probes Cat# L34966 Deposited data Single cell RNA sequencing NCBI Sequence Read Archive project ID PRJNA714499 Processed scRNA sequencing data Figshare.com https://doi.org/10.6084/ m9.figshare.19706530 Experimental models: Organisms/strains Mouse: C57BL/6 Charles River N/A Mouse: APP KM670/671NL- B6.Cg-Tg(Thy1-APP) 3Somm/J (APP23) (Busche et al., 2008) JAX Cat# 030504 Mouse: Tg(Thy1-PSEN1*G384A)45Jckr (Busche et al., 2008) MGI:4819105 Mouse: Trem2-IPD This manuscript N/A Mouse: APP23xPS45xIPD This manuscript N/A Mouse: Trem2-KO KOMP Repository Project ID VG10093 Mouse: Tau58.4 Yin et al. (2017) N/A Oligonucleotides gRNAs #1 (complementary sequence: 50-gggaccac tactgtacctgg), IDT N/A gRNAs #2 (forward sequence: 50- aagtggaacacagcacctcc) IDT N/A KI primers:778-Trem2-CR-6 (50-gatagggaatc gacca gaggc) and 774-Trem2-CR-2 (50-actgtac ctcgagtcg gggat) This manuscript N/A WT primers: 775-Trem2-CR-3 (50-caagtggaacacagca cctcc) and 777- Trem2-CR-5 (50-aggtatgt ggctgctcaggg) This manuscript N/A Human APP primers: forward 50- ccactggctgaagaaagtgac aat, reverse 5’ -cctctacctcatcaccatcctcat Microsynth AG N/A Human PSEN1 primers: forward 5’ -cagatgtctgaggacaacc acctg, reverse 5’ -cctcatcttgctccaccacctgcc Microsynth AG N/A 18S rRNA primers: forward 5’ -gatccattggagggcaag tct, reverse 5’ -ccaagatccaactacgagcttttt Microsynth AG N/A Gapdh primers: forward 5’ -ggtgctgagtatgtcgtggag, reverse 50-gcggagatgatgaccctttt Microsynth AG N/A Hprt primers: forward 5’ -tcccagcgtcgtgattagc, reverse 5’ - tgtaatccagcaggtcagca Microsynth AG N/A Software and algorithms ImageJ https://imagej.net |